Projek Sarjana Mude (PSM)

Posted by Syafarah Saturday, April 25, 2009 Posted under -

Bismillahirrahmanirrahim, dengan nama Allah yang maha pemurah lagi maha mengasihani..

Assalamualaikum wa rahmatullah & salam sejahtera to all,

Lepas exam PCI (process control and instrumentation yg bessss), para pelajar Kejuruteraan Kimia musti gerak ke fakulti untuk sesi pemilihan tajuk PSM (projek sarjana muda. kalo u lain diberi name projek akhir).

Kami perlu pilih 3 tajuk, dan salah 1 tajuk akan jadi kompom tajuk kite (ade gak dapat laen). Macam isi borang UPU r.
Kelebihan kos ana, Kejuruteraan Kimia (Bioteknologi) ielah, kami leh pilih tajuk kos laen sekali, tapi kos laen x bley pilih tajuk kami. cewahh, tgh riak neh. bwahahaaa~. ishk, tak baek.. dak-dak dean list diorang gak selalu. huhuuhu..

Ana pilih 3 tajuk (bio related r. tak minat sangat kire-kire nih):

1. Biodegradable plastic research group
2. Production of Glucose by Using Enzymatic Hydrolysis Method
3. Production of Sorbitol from Glucose by Using Fermentation Process

Kirenye, no.1 tu paling menarik di jiwa..
Then, letak la borang tuh dalam kotak yg disediekan kat depan bilik puan Aini "Ya Allah, bagi la ape-ape tajuk yang TERBAIK untuk aku. Aku redha (teringat surah al-Baqarah:216)"


24 April 2009
1.56pm
Sebelum nak pegi exam Molecular and Cell Biology kul 2.30pm

Kak Syikin: (masuk dalam bilik ngn muke tak pueh ati) Syafarah tau tak dah kuaq tajuk PSM?
Ana: Hah?! dah kuaq ka? (terus menempel depan laptop dan setelah beberapa saat tengok monitor, baru sedaq tatau hala tuju) err, kat mana kak?
Kak Syikin: Kat e-notes
Ana: Ooooo (sambil tekan dengan laju, almaklum la, tak sabaq-sabaq)
Kak Sikin: Alaaaa, Syafarah dapat apa Syafarah nak.. (lagi berbunga liver nihhh).. kak Syikin dapat neh (dengan muka monyok): Encapsulation of natural dye by cyclodextrin: effect of cyclodextrin types & method of inclusion (gulp! bapak tak paham..huhhuhhh)

Ana pon cari nama ana..... searchinggg.....

YESSSS!! Alhamdulillah!!!! dapat Biodegradable Plastic Rearch Group (2 orang 1 group, tapi parameter berbeza)!!
Supervisor: Prof.Ir.Dr Jailani Salihon.. Errrrkkkkkkkk.. adeyhhhh, ngan Prof Jai ka.. nebes nehhh (nebes=nervous).. ye la, keje ngan orang pandai + wara'.. tengok-tengok dia leh i'rab orang.. maluuuu~


24 April 2009
2.15pm
Depan Dewan Exam
Lepak-lepak dengan notes dan classmate lain

Syafarah: Dayah, betui ka tajuk *kami ni tajuk **grant?
Dayah: Haah. Kenape?
Syafarah: Adehh.. takut la.. kami bukannya pandai sangat sampai nak dapat tajuk grant..... amanah ni..
Dayah: Takpe Syafarah.. Ade hikmah sume ni. Maybe ade ape-ape tersirat sebalik ape tajuk Allah bagi kat Syafarah tu..
Syafarah: Haah, btoi! Tima kasih Dayah.. Sejuk balik dah ati ni....


Moral value la kan,

1. Letakkan harapan dan nasib kat Allah, Allah akan tolong kita.
Jangan letak pada orang or kemampuan dan bakat diri.
(contoh: "eh, aku pandai dalam bidang ni, mesti leh buat"."aku datang awai, mesti dapat r tajuk aku nak!"."aku dah bagi maruah aku kat die, die mesti kawen ngan aku" (hahahaa, xdenye. dah dapat mahkote ngko, die tinggal je ngko. die cari gak bakal mak anak die yang leh didik anak dengan Islam. but, dun worry, kalo dah taubat nasuha, iza biiznillah Allah bagi yang terbaik untuk kita :) ingat, bergantung pada Allah)

2. Bersyukur dengan ape yang dapat.
Cam tadi, ana rase tak mampu dengan ilmu ana sekarang. Tapi Dayah tenangkan ana balik bahawe setiap ketentuan Allah tu memang Allah dah well-planned siap-siap.
Sapa tau, maybe dengan grant project tuh, leh fly masuk pertandingan kat Geneva ke Austria ke. fuwaaaaa~ (dah kembang kempis idong duk berangan)
Lagi bes, kalo dapat contribute to Islam dengan projek nih.. mmmm~

nota kaki ayam:
*kami = 'saya' dalam bahasa utara. takut-takut nanti orang salah tafsir lak kan. huh
**grant = Setiap IPTA akan dapat beberapa juta (ntoh le berape) RM untuk RnD. Tajuk ana tuh kirenye grant project untuk Prof Jai r. Doakan la ana.. huhuhuhuu~

read more “Projek Sarjana Mude (PSM)”

Projek Final Sebelum Final. erk, ayat ape ni? Ayat-ayat Cinta?

Posted by Syafarah Wednesday, April 15, 2009 Posted under -

Bismillahirrahmanirrahim, dengan nama Allah yang maha pemurah lagi maha mengasihani..

Assalamualaikum wa rahmatullah & salam sejahtera to all,

Final assignment untuk Bioseparation Engineering adalah detailkan proses production pasal projek group masing-masing mase Bioreactor Engineering dolu-dolu. Projek group kami tajuknye: "Production of Insulin by Using Bioreactor".
tu tajuk dolu-dolu zaman mude-mude hingusan lahik. Tajuk sekarang ielah: "Production of Glargine Insulin". Glargine insulin ni diproduce gune Escherichia coli K12. Kalo tak pakai glove handle bliau ni, memang ceret-beret. First year dulu dah kene. nguahaaa..

Ye la, projek dolu-dolu tak payah detail sangat. As we grow dlm kos handasah ni, terpakse la mendetailkan setiap mende.

Haaaa, sapa yang nak tau leh bace, sape tanak leh bace gak, tapi awat nak baca kalau tanak? adeyy~

Kat bawah ni surface-surface je ana letak. Kalau nak letak sume projek info kami, tak jadi blog la pulak. Bukannye korang pon nak bagi markah kan?

__________________

Jom berkenalan ngan Glargin Insulin a.k.a Lantus
  • Used in the treatment of type I and type II diabetes.
  • The primary activity of Glagin Insulin is the regulation of glucose metabolism.
  • In muscle and other tissues (except the brain):
- insulin causes rapid transport of glucose and amino acids intracellularly.
In the liver
- insulin promotes the uptake and storage of glucose in the form of glycogen, inhibits gluconeogenesis, and promotes the conversion of excess glucose into fat.
Promotes anabolism, and inhibits protein catabolism.

Kat bawah ni kod untuk Gene Sequence beliau (kat receptor SAHAJE, bukan keseluruhan protein tuh.. SUBHANALLAH~)

ATGGGCACCGGGGGCCGGCGGGGGGCGGCGGCCGCGCCGCTGCTGGTGGCGGTGGCC
GCGCTGCTACTGGGCGCCGCGGGCCACCTGTACCCCGGAGAGGTGTGTCCCGGCATGG
ATATCCGGAACAACCTCACTAGGTTGCATGAGCTGGAGAATTGCTCTGTCATCGAAGG
ACACTTGCAGATACTCTTGATGTTCAAAACGAGGCCCGAAGATTTCCGAGACCTCAGT
TTCCCCAAACTCATCATGATCACTGATTACTTGCTGCTCTTCCGGGTCTATGGGCTCG
AGAGCCTGAAGGACCTGTTCCCCAACCTCACGGTCATCCGGGGATCACGACTGTTCTT
TAACTACGCGCTGGTCATCTTCGAGATGGTTCACCTCAAGGAACTCGGCCTCTACAAC
CTGATGAACATCACCCGGGGTTCTGTCCGCATCGAGAAGAACAATGAGCTCTGTTACT
TGGCCACTATCGACTGGTCCCGTATCCTGGATTCCGTGGAGGATAATCACATCGTGTT
GAACAAAGATGACAACGAGGAGTGTGGAGACATCTGTCCGGGTACCGCGAAGGGCAA
GACCAACTGCCCCGCCACCGTCATCAACGGGCAGTTTGTCGAACGATGTTGGACTCAT
AGTCACTGCCAGAAAGTTTGCCCGACCATCTGTAAGTCACACGGCTGCACCGCCGAAG
GCCTCTGTTGCCACAGCGAGTGCCTGGGCAACTGTTCTCAGCCCGACGACCCCACCAAG
TGCGTGGCCTGCCGCAACTTCTACCTGGACGGCAGGTGTGTGGAGACCTGCCCGCCCC
CGTACTACCACTTCCAGGACTGGCGCTGTGTGAACTTCAGCTTCTGCCAGGACCTGCA
CCACAAATGCAAGAACTCGCGGAGGCAGGGCTGCCACCAATACGTCATTCACAACAAC
AAGTGCATCCCTGAGTGTCCCTCCGGGTACACGATGAATTCCAGCAACTTGCTGTGCA
CCCCATGCCTGGGTCCCTGTCCCAAGGTGTGCCACCTCCTAGAAGGCGAGAAGACCATC
GACTCGGTGACGTCTGCCCAGGAGCTCCGAGGATGCACCGTCATCAACGGGAGTCTGA
TCATCAACATTCGAGGAGGCAACAATCTGGCAGCTGAGCTAGAAGCCAACCTCGGCCT
CATTGAAGAAATTTCAGGGTATCTAAAAATCCGCCGATCCTACGCTCTGGTGTCACTT
TCCTTCTTCCGGAAGTTACGTCTGATTCGAGGAGAGACCTTGGAAATTGGGAACTACT
CCTTCTATGCCTTGGACAACCAGAACCTAAGGCAGCTCTGGGACTGGAGCAAACACAA
CCTCACCACCACTCAGGGGAAACTCTTCTTCCACTATAACCCCAAACTCTGCTTGTCAG
AAATCCACAAGATGGAAGAAGTTTCAGGAACCAAGGGGCGCCAGGAGAGAAACGACAT
TGCCCTGAAGACCAATGGGGACAAGGCATCCTGTGAAAATGAGTTACTTAAATTTTCT
TACATTCGGACATCTTTTGACAAGATCTTGCTGAGATGGGAGCCGTACTGGCCCCCCG
ACTTCCGAGACCTCTTGGGGTTCATGCTGTTCTACAAAGAGGCCCCTTATCAGAATGT
GACGGAGTTCGATGGGCAGGATGCGTGTGGTTCCAACAGTTGGACGGTGGTAGACAT
TGACCCACCCCTGAGGTCCAACGACCCCAAATCACAGAACCACCCAGGGTGGCTGATGC
GGGGTCTCAAGCCCTGGACCCAGTATGCCATCTTTGTGAAGACCCTGGTCACCTTTTCG
GATGAACGCCGGACCTATGGGGCCAAGAGTGACATCATTTATGTCCAGACAGATGCCA
CCAACCCCTCTGTGCCCCTGGATCCAATCTCAGTGTCTAACTCATCATCCCAGATTATTC
TGAAGTGGAAACCACCCTCCGACCCCAATGGCAACATCACCCACTACCTGGTTTTCTGG
GAGAGGCAGGCGGAAGACAGTGAGCTGTTCGAGCTGGATTATTGCCTCAAAGGGCTG
AAGCTGCCCTCGAGGACCTGGTCTCCACCATTCGAGTCTGAAGATTCTCAGAAGCACAA
CCAGAGTGAGTATGAGGATTCGGCCGGCGAATGCTGCTCCTGTCCAAAGACAGACTCT
CAGATCCTGAAGGAGCTGGAGGAGTCCTCGTTTAGGAAGACGTTTGAGGATTACCTGC
ACAACGTGGTTTTCGTCCCCAGAAAAACCTCTTCAGGCACTGGTGCCGAGGACCCTAGG
CCATCTCGGAAACGCAGGTCCCTTGGCGATGTTGGGAATGTGACGGTGGCCGTGCCCAC
GGTGGCAGCTTTCCCCAACACTTCCTCGACCAGCGTGCCCACGAGTCCGGAGGAGCACAG
GCCTTTTGAGAAGGTGGTGAACAAGGAGTCGCTGGTCATCTCCGGCTTGCGACACTTCA
CGGGCTATCGCATCGAGCTGCAGGCTTGCAACCAGGACACCCCTGAGGAACGGTGCAGTG
TGGCAGCCTACGTCAGTGCGAGGACCATGCCTGAAGCCAAGGCTGATGACATTGTTGGCC
CTGTGACGCATGAAATCTTTGAGAACAACGTCGTCCACTTGATGTGGCAGGAGCCGAAG
GAGCCCAATGGTCTGATCGTGCTGTATGAAGTGAGTTATCGGCGATATGGTGATGAGG
AGCTGCATCTCTGCGTCTCCCGCAAGCACTTCGCTCTGGAACGGGGCTGCAGGCTGCGTG
GGCTGTCACCGGGGAACTACAGCGTGCGAATCCGGGCCACCTCCCTTGCGGGCAACGGCT
CTTGGACGGAACCCACCTATTTCTACGTGACAGACTATTTAGACGTCCCGTCAAATATTG
CAAAAATTATCATCGGCCCCCTCATCTTTGTCTTTCTCTTCAGTGTTGTGATTGGAAGTA
TTTATCTATTCCTGAGAAAGAGGCAGCCAGATGGGCCGCTGGGACCGCTTTACGCTTCTT
CAAACCCTGAGTATCTCAGTGCCAGTGATGTGTTTCCATGCTCTGTGTACGTGCCGGACG
AGTGGGAGGTGTCTCGAGAGAAGATCACCCTCCTTCGAGAGCTGGGGCAGGGCTCCTTCG
GCATGGTGTATGAGGGCAATGCCAGGGACATCATCAAGGGTGAGGCAGAGACCCGCGTGG
CGGTGAAGACGGTCAACGAGTCAGCCAGTCTCCGAGAGCGGATTGAGTTCCTCAATGAGG
CCTCGGTCATGAAGGGCTTCACCTGCCATCACGTGGTGCGCCTCCTGGGAGTGGTGTCCAA
GGGCCAGCCCACGCTGGTGGTGATGGAGCTGATGGCTCACGGAGACCTGAAGAGCTACC
TCCGTTCTCTGCGGCCAGAGGCTGAGAATAATCCTGGCCGCCCTCCCCCTACCCTTCAAG
AGATGATTCAGATGGCGGCAGAGATTGCTGACGGGATGGCCTACCTGAACGCCAAGAAG
TTTGTGCATCGGGACCTGGCAGCGAGAAACTGCATGGTCGCCCATGATTTTACTGTCAA
AATTGGAGACTTTGGAATGACCAGAGACATCTATGAAACGGATTACTACCGGAAAGGG
GGCAAGGGTCTGCTCCCTGTACGGTGGATGGCACCGGAGTCCCTGAAGGATGGGGTCT
TCACCACTTCTTCTGACATGTGGTCCTTTGGCGTGGTCCTTTGGGAAATCACCAGCTTG
GCAGAACAGCCTTACCAAGGCCTGTCTAATGAACAGGTGTTGAAATTTGTCATGGATGG
AGGGTATCTGGATCAACCCGACAACTGTCCAGAGAGAGTCACTGACCTCATGCGCATGT
GCTGGCAATTCAACCCCAAGATGAGGCCAACCTTCCTGGAGATTGTCAACCTGCTCAAGG
ACGACCTGCACCCCAGCTTTCCAGAGGTGTCGTTCTTCCACAGCGAGGAGAACAAGGCTC
CCGAGAGTGAGGAGCTGGAGATGGAGTTTGAGGACATGGAGAATGTGCCCCTGGACCG
TTCCTCGCACTGTCAGAGGGAGGAGGCGGGGGGCCGGGATGGAGGGTCCTCGCTGGGT
TTCAAGCGGAGCTACGAGGAACACATCCCTTACACACACATGAACGGAGGCAAGAAAAAC
GGGCGGATTCTGACCTTGCCTCGGTCCAATCCTTCCTAA

huwahuwaaaaaa

Ade 5 Steps dalam production of Glargin Insulin

1. FERMENTATION
  • Lantus is produced by recombinant DNA technology utilizing a non-pathogenic laboratory strain of Escherichia coli (K12) as the production organism.
  • Insulin glargine differs from human insulin in that the amino acid asparagines at position A21 is replaced by glycine and two arginines are added to the C-terminus of the B-chain.
  • Genetically modified E.Coli bacteria are cultured and grown in fermenters.
  • Then killed by disinfectant.

2. CENTRIFUGATION
  • Bacterial suspension is concentrated and then disintegrated.
  • In some cases:
- Samples were centrifuged at 10,000g for 30 min and postmitochondrial supernatant was used for fatty acyl-CoA oxidase assay. (if there’s lipid involve)


3. SEPARATION & ISOLATION
  • Fusion protein is separated from the other cell components.
  • In some cases:
- Using chromatographic separation or;
- Separated by differential ultracentrifugation at 100,000g (Beckman Ultracentrifuge)
  • Then, washed twice with water then isolated.

4. PURIFICATION
  • Glargin insulin is freed of urea and inorganics salts with adsorption-desorption steps and simultaneously concentrated.

5. END PRODUCT TREATMENT
  • Produce a product of medicine in solid and liquid phase in a clean room at least in class C
  • Insulin product is crystallized, deep frozen (under clean room conditions) and is then ready for fill and finished.
  • The new inhalable insulin product requires the insulin to be put through a process called micronization (very small particles are produced suitable for blister capsules to be used in a normal inhaler).

Tapi, setakat ni, Galrgine insulin terdapat dalam bentuk injection je. Yang inhalable tu very new technology. Setakat ilmu ana yang amat skeeettttt ni la.. huhuuhh

___________________

Mmmm, dah lame takde pengisian tarbiyyah kan.
Dalam kesibukan esemen, projek, test, kuiz dan final exam, ana doakan iman kite masih mengharum walaopun bizi-bizi ni..

Ana cadangkan, kalo bizi sangat, kite habiskan at least beberapa minit untuk bace buku tarbiyyah (bace al-Quran of kos ari-ari). Satu muka setiap ari pun jadi la. Asalkan tarbiyyah tu still berjalan setiap ari .. p(^0^)q kambatte minna-san!

read more “Projek Final Sebelum Final. erk, ayat ape ni? Ayat-ayat Cinta?”

Dah leh kawen dah~ lalaa~

Posted by Syafarah Sunday, April 12, 2009 Posted under - , ,

Bismillahirrahmanirrahim, dengan nama Allah yang maha pemurah lagi maha mengasihani..

Assalamualaikum wa rahmatullah & salam sejahtera to all,

Alhamdulillah, dah tamat Kursus Pra-Perkahwinan JAIP.
Dah leh kawen~.. nguahahaaaa..
Betulkan niat. Jangan gatai sangat na.. bukan nak SIJIL je, tapi nakkan ILMU tu.
Tapi, ilmu tanpa amal takleh jugak kan?
Bak kate ustaz Hafiz: "Cepat-cepat sket kawen, nanti lupa lak isi kursus ni". Tapi ustaz, ana takde calon lagi. Nak kawen cemana? Mak pun tak bagi greenlight.. terpakse la amalkan lambat lagik.. huhuuu.

Ade 8 slot kesemuenye yang musti diperabihkan dalam plus minus 16 jam. Mengah seyh..

Nak tau ape pengisiannye? Terpakse la join senirik. huhuu (promosi ni.. JAIP tanak bayar komisen ke??)

Bakal bini dan ibu. Leh caye ke korang? Jangan korang dera suami udah le.. ngehhehee

Takde koje. Dah bosan sangat, nangkap le gambor ala-ala spy gitu.
Kalo tido, membaziaq RM50 lak. huh.

Majlis perasmian penutup oleh Ketua Hakim Mahkamah Syariah Kuantan.
Huwaa~.. terpakse bayangkan je jemari halus tuh adalah jemari ana and jemari yang menyarung tuh jemari tuuuttt (tak tau lagi sape.. huhuu)

Haa, ni la dalam fail yang disediekan.
Yang pen Save Gaza tuh penambah perisa jek.

Hehee.. ni buku tambahan je.
Masa ana nak beli buku ni, kat daurah bulan Januari lepas rasenye.
Mase tuh takde duit, nak pinjam kat naqibah ana, amat laaaaa Allah je tau malunye ana.
"Buku ape nak beli?" kak Hamnah tanye.
"Ade laaaa~" Muka ana dah merah (tengah sorokkan buku kat belakang).
"Haaaaa~. kak dah nampak dah.. buku kaler pink! Tau dahhhh buku ape.."
Maluuuu~. bukan ape, kak Maryam, mak ana, ustaz Hilmi sume tak kasi kawen lagi.
"Belajo abih dulu"
"Tumpu kat study"
"Bukan senang kawen ni. Banyak masalahnye"
"Pas study, baru ustaz bagitau kat bakal zaujah ustaz yang ustaz nak kat die"

Mak ana lagi la, still ingat ana umo 11 tahun.. Takpe-takpe, sekarang la nak manje-manje ngan mak ayah. Kalu dah kawen, priority kat my dear hubby dah..


K la. Setakat ni dulu. Nak siap-siap balik umah abang kat Selayang. Malam ni bertolak.
Di laen mase, iza biiznillah ana post pasal pengisian kursus nih (yang bes-bes je la)..

read more “Dah leh kawen dah~ lalaa~”

Uwekkkkkk~

Posted by Syafarah Monday, April 6, 2009 Posted under - ,

Bismillahirrahmanirrahim, dengan nama Allah yang maha pemurah lagi maha mengasihani..

Assalamualaikum wa rahmatullah & salam sejahtera to all,

Sharing is caring rite?
Nak share sket bende yg terdiscover kat Pilot Plant Lab FKKSA (Fakulti Kejuruteraan Kimia dan Sumber Asli)

(Pilot Plant: Scale-up macam indusri. Tapi lebih kicik)

Beberapa unit Pilot Plant yang sempat disnap:
(banyak lagi.. nak tengok, mai la sini..)

Solid-Liquid Extraction Unit........ punye tangga.
Aphal la amek gambaq tangga dia? adey laaaa~

Para bakal jurutera kimia (insyaAllah) yang senget (tu, tuan punye tangan kat bawah tu lagi senget) tengah mengisi SiO2 (pasiaq la sonang) untuk diextract NaCl (sodium cloride atau dalam bahasa saintifiknyo: GARAM) dari beliau.

Rotary Evaporator Unit.
Adeh, busyuknye ethanol.. Kene pakai glove ngan mask. Kalau tak, insyaAllah sakit perut. Kawan dah kene. huh..


Ok, kembali kepada cita kite tadi:

Pada suatu ari, ana memang terkenal ngan sifat tak malu (malu bertempat r kan.. huhuhh).
Maka, dengan sifat itu ana terus meluru berlari-lari anak (nak lari laju-laju kang berpeluh, kurus lak. Bila kurus jadi cun. Tanak r. Biarla orang laen cun. Nanti ramei sangat nak kat ana, susah gak.. ;p) ke arah Jurutera Pengajar (JP) kami yang sedang mengisi something ke dalam beg plastik. Serbuk tu berwarna kecoklatan.

Ana: Pe tu, incek?
Incek: Haa, ni la kacip timah.
Ana: Biaq btoi incek.. (eh, ni lab ke kilang Power Akaq?)
Incek: Btoi rrrrr. Nah, amek raso..
Ana: (dengan perasaan masih lagi was-was dengan kewarasan JP tersibut, ana berlari-lari baby lagi ke arah singki berdekatan untuk menyucikan tangan ini. JP-JP kami memang sengal, btoi ke idok diorang ni..)
Ana: Nah! (sambil menghulurkan tangan kananku yang sedap mata memandang, sedap lagi bahu memikul)

Disebabkan kacip timah tu baru lepas melalui proses Purification (Extraction) --> Polishing (Crystalization), serbuk-serbuknye masih warm lagi apabila me'landing' atas tangan ni. (Maaf, reactornye lupa lak ana nak tangkap dalam gambor. Gomen-nasai!)

Ana pon rase. Bapak pahet!!!! Tapi, sedap gak r. Die pahit bila sampai kat tekak je.
Disebabkan banyak lagi timah punye kacip di tanganku, ana pun bawak le merata pi kat suma kekawan ana untuk disharing caringkan. Ramai gak tanak rase. huhuuuhh~.

Rupanya, banyak lagi JP-JP kami proses..

Senarai projek diorang. Confidential ke ni? Sesuke liver ana je letak sini..

Extraction of vanilla dah lame buat. Ni diorang display je.

Ade muhadhir(lecturer) kami tengah wat paper pasal extraction of essential oils from gaharu. Die wat enhancement kat prosesnye, means tengah cari jalan yang lebih baik untuk extract essential oils dari gaharu ni.

Haa, ni la beliau kacip timah..

Haaaaa.. ni paling besh, baek punya!
Cuba teka, apakah ini???????






teka lagi..


.....



..









......


dun give up!!




..







.....

.
.



..

.



.....










jeng jeng.................




Ewwwwww~!
Ekstrak cakcing ni kaya dengan protein. Protein baik untuk membina sel-sel baru, mencantikkan wajah, macam-macam lagi la..
Ape gunenye ekstrak cakcing ni??
Gunenye untuk KOSMETIK: bedak, lipstik, celak, eye shadow etc.
Nak pakai mekap lagi????? bwahaaaha~


Maka, jangan putus asa menuntut ilmu. Perjuangan takkan selesai sampai akhirat..
dan, kerjaya mencabar yang mesti banyak bergerak (i.e. engineer etc.) bukan la alasan untuk pakai pakaian tak menutup aurat. Leh je pakai seluar, tapi pakai la blouse/t-shirt yang labuh dan longgar. Still vogue dan cantik gitu. k kan??

Setakat ni je share from ana. Iza biiznillah, kite share lagi..

read more “Uwekkkkkk~”

Naek Bulu Roma lagik..

Posted by Syafarah Posted under - , ,

Bismillahirrahmanirrahim, dengan nama Allah yang maha pemurah lagi maha mengasihani..

Assalamualaikum wa rahmatullah & salam sejahtera to all,

Ana ske sirah. tak kesah, sirah anbiya' (Nabi Isa a.s and Rasulullah s.a.w speseli), dari zaman khulafa' ar-rasyidin sampai abbasiyah, Knights of Templar, Freemasons etc.

Kisah-kisah sahabat Rasulullah s.a.w pom bes jugak. Sambil-sambil study, dengar lagu album baru In-Team (Allahurabbi 2009) terus tertarik dengan lagu neh. Memang banyak iktibar.. Mengingatkan balik kisah ketika perang Uhud. Disebabkan ketamakan tentera Islam masa tu, tak nak dengo ape Rasulullah s.a.w oyak, depa terus nak amik harta musuh yang dibajet tewas tuh. Daripada mula-mula elok menang, then bertuko menjadi kekalahan yang teruk + dasyat. Ramai yang gugur, termasuk ayah sedara Rasulullah s.a.w, Hamzah Asadullah....


Hamzah Asadullah

Kesedihan para mukminin
Masih terpancar di pedang mursyirikin
Sedang darah para syuhada
Masih merah dilantai sirah

Ketamakkan kepada harta
Mungkin itu jadi puncanya
Maka Allah menjadi murka
Sehingga Nabi pun turut terluka

Dalam ramai umat yang gugur
Satu jasad tubuhnya hancur
Kepiluan beratapan
Menangisi satu kehilangan

Dan setelah dikenal pasti
Dia Hamzah perisai Nabi
Biar nyawa dikorbankan
(jiwa raga dikorbankan)
Agar Islam tetap terselamat

Disebalik ketewasanmu
Ada syurga sedang menunggu
Tiap perintah mengandung hikmah
Keingkaran kan mengundang padah

Laailahaillallah
Hua saiduna Hamzah sidullah
Dikaulah perisai Rasulullah
Berjuang berkorban demi Allah

Sudahkah puas hatimu Hendon
Dapat melapah hati dan jantung
Terbalaskah dendam kesumat
Yang sekian lama telah tersemat

read more “Naek Bulu Roma lagik..”

Sentap Jiwa

Posted by Syafarah Posted under - , , ,

Bismillahirrahmanirrahim, dengan nama Allah yang maha pemurah lagi maha mengasihani..

Assalamualaikum wa rahmatullah & salam sejahtera to all,

Junior ana, Naeem bagi macam-macam lagu from album terbaru Rabbani (Nada Murni), In-Team, Hamza Namira and Sami Yusuf.

Sebelum lagu Forever Palestine from Sami Yusuf, ade interlude. Suara adik kicik. Kata-katanya amat membekas di jiwa. Kalau Israel dengaq ni, memang cair (kalau ade secebis kemanusiaan r. Tapi musykil.. ade ke perahsaan tu lagi kat diorang????)


All your armies, all your fighters
All your tanks, and all your soldiers
Against a boy holding a stone
Standing there all alone

In his eyes I see the sun
In his smile I see the moon
And I wonder, I only wonder
Who is weak, and who is strong?
Who is right, and who is wrong?
And I wish, I only wish
That the truth has a tongue

Album baru Sami Yusuf (Without You) memang bes. Liriknye mengancam. Naek bulu roma. Ade pasal Palestine, pasal salah faham Muslim tentang Jihad (i.e mengganas kerana Fi Sabilillah etc), and banyak lagi.. BES!

read more “Sentap Jiwa”

"Dear Aiman.. "

Posted by Syafarah Posted under -

Bismillahirrahmanirrahim, dengan nama Allah yang maha pemurah lagi maha mengasihani..

Assalamualaikum wa rahmatullah & salam sejahtera to all,

2 minggu yang lalu adalah minggu yang agak stress bagi jiwa ini. huh. Maka, dengan sukacitanya membawa diri ke pangkuan umah abang sulung ana kat Selayang atas tiket: "tolong kat kedai".

Ingat lagi tak Aiman? --> Ucu Sayang Aiman..

-------------------------------------------------

" Dear Aiman,

Kaifa haluka? Mesti Aiman seronok kan? Ye la, Aiman suci lagi, takde dose pom lagi..

Ucu pegi umah Aiman 2 minggu lepas. Mase Aiman pergi 5 Mac yang lepas, Ucu tak sempat nak tengok Aiman wat kali terlast. Tiket dah abis, tiket kol 10pm je ade, Aiman lak depa simpan (kuarga ana tak panggil 'tanam'. kuarga ana panggil 'simpan') 6.30pm. Ucu tak sempat.. Esoknye, opah, tuk wan, ummi and abi Aiman ziarah Aiman kat kubo. Ucu tak leh nak ikut sebab ade keuzuran.. Ucu tak sempat tengok 'umah baru' Aiman.....

Masa 2 minggu lepas, alhamdulillah, Allah bagi keizinan untuk Ucu ziarah Aiman. Masa tuh kul 6pm, awan komulunimbus kekelabuan datang skali time tuh. Alhamdulillah, dari awal bace Yaasin, sampai abis, sampai masuk keta, ujan setitik pom tak sentuh bumi. Allah bagi kemudahan untuk ziarah Aiman..

Ummi Aiman sedeh lagi.... Abi Aiman sedeh lagi.... Opah, Tuk Wan, Wan Aiman pun sedeh.... Tapi, Allah dah plan awai-awai lagi. 2 minggu sebelum Aiman pegi, opah and tuk wan Aiman sempat jage Aiman seminggu kan? Subhanallah, plan Allah maha hebat....

K la Aiman. Ucu pi dulu na. Kami doakan kesejahteraan Aiman walaupun Aiman suci sangat takde dosa~ Muaahhhhhxxxx.. Maassalaamah..

p.s- Cayang Aiman.."


----------------------------------------------

Masa sambut besday ke-4, besday terbes bagi Aiman (Umminye yang habaq)

Besday kek SuperAiman~

Umah baru Aiman....

read more “"Dear Aiman.. "”

1 Jam 58 Menet Sebelum Saatnya Berjuang..

Posted by Syafarah Sunday, April 5, 2009 Posted under - ,

Bismillahirrahmanirrahim, dengan nama Allah yang maha pemurah lagi maha mengasihani..

Assalamualaikum wa rahmatullah & salam sejahtera to all,

Dah lame berabuk kan? Sawang dah berselerak neh ha.. adeyh, vacuum!!

Takde ape-ape nak tulih.. Banyak terjadi dalam idop ni sejak tak mengupdate: Turun naek iman, letrik ade takde cam beskut, down tahap kamenrider sebab test cam sengal, konsert Rabbani etc.

Haa, ri ni ade test Bioseparation Engineering. Besh giler.. Topik yang masuk: Precipitation, Extraction ngan Adsorption. Besh giler lagik skalik. Erk, perlu ke bagitau kat sini bab-bab yang masuk test? Korang nak amek tau ke sebenornye? Adeyh, pelek la makcik Syafarah ri ni.

Dah kul 6.02pm waktu Malaysia. Lagi 1 jam 58 menet lagik sebelum test bermola. huhuuuuuuuuhuu~.

Semalam baru kol koling ngan lelaki buah hatiku. Lelaki yang paling care pasal ana. Ape-ape jadi kat ana, bliau la antara yang gelabah. Bliau la Pak Ya, my daddy, abi, otou-chan, papa, ayah.

Brikut adalah dialog yang terpilih untuk disiarkan untuk tatapan umum:-

Ayah: Camna test? (soklan standard kalau tepon)
Ana: Yang test 1 nye result dah kuor r. Alhamdulillah, baek-baek aja. Test 2 baru je wat, ade yang tak wat lagi. Maka result tak kuar lagi.
Ayah: Camna yang dah wat tuh?
Ana: .......................................... CRE (Chemical Reaction Engineering) N** (panggilan manje kat umah. Tak leh ditulis di sini. huhuuu) dah study. Yang soklan spot, hint sume dah study. Tapi, soklan yang betul-betul super hint N** study las-las. Time test, konfiden ja jawab. Tapi bila abih, jawapan ngan kekawang tak sama.................................... Pehtu, skang ni N** kachiwa gila. Dean List tak dapat r sem ni.. Skang asek tengok movie ja. Study pom sket2 je.. Kachiwa........................................
Ayah: Laaaaa~. Mane leh camtu. Jangan putus asa..------


(Talian terputuih. Awat ntah. Beberapa minit kendian, ayah kol balik)

Ayah: Jangan putus asa na. N** kiranya dah hebat tau. Mak ngan ayah pun tak masuk u.
Ana: Ala, ayah ngan mak lagi pandai. Lagi layak masuk u. Just tak ckup duit ja, sebab tu mak ngn ayah tak leh masuk u.
Ayah: Haa, skang hang mampu, jangan putuih asa.
(tak leh r bila ayah bagi muhasabah diri nih. dah mula stat sungai kat pipi neh..baru nak tersedor duit mak, ayah ngan rakyat yang ana guna skang. harapan mak ayah lagi.........)
Ayah: buat baek-baek na. Tanak putuih-putuih asa dah tau. Sampai bila-bila ka nak gagal?
Ana: ... (kalo dah cry me a river, xkuar suara dah.. huhuu)
Ayah: Belajaq tau.....


k la, sampai sini je citer. ade lagi part-part sadis, tapi tu je la nak cite.

lepaih tu, YOSH! kambatte! ayah telah membangkitku semula dari lena!

Skang niat belajo masih lagi tak mencapai target (almaklum la, iman kering sejak 2 menjak ni): belajaq sebab Allah taala. Skang mode belajaq sebab amanah rakyat and harapan mak ayah.....

nak study sket lagi...... doakan kejayaan kami kat sini, na!

read more “1 Jam 58 Menet Sebelum Saatnya Berjuang..”
bookmark
bookmark

ShoutMix chat widget