Projek Final Sebelum Final. erk, ayat ape ni? Ayat-ayat Cinta?

Posted by Syafarah Wednesday, April 15, 2009

Bismillahirrahmanirrahim, dengan nama Allah yang maha pemurah lagi maha mengasihani..

Assalamualaikum wa rahmatullah & salam sejahtera to all,

Final assignment untuk Bioseparation Engineering adalah detailkan proses production pasal projek group masing-masing mase Bioreactor Engineering dolu-dolu. Projek group kami tajuknye: "Production of Insulin by Using Bioreactor".
tu tajuk dolu-dolu zaman mude-mude hingusan lahik. Tajuk sekarang ielah: "Production of Glargine Insulin". Glargine insulin ni diproduce gune Escherichia coli K12. Kalo tak pakai glove handle bliau ni, memang ceret-beret. First year dulu dah kene. nguahaaa..

Ye la, projek dolu-dolu tak payah detail sangat. As we grow dlm kos handasah ni, terpakse la mendetailkan setiap mende.

Haaaa, sapa yang nak tau leh bace, sape tanak leh bace gak, tapi awat nak baca kalau tanak? adeyy~

Kat bawah ni surface-surface je ana letak. Kalau nak letak sume projek info kami, tak jadi blog la pulak. Bukannye korang pon nak bagi markah kan?

__________________

Jom berkenalan ngan Glargin Insulin a.k.a Lantus
  • Used in the treatment of type I and type II diabetes.
  • The primary activity of Glagin Insulin is the regulation of glucose metabolism.
  • In muscle and other tissues (except the brain):
- insulin causes rapid transport of glucose and amino acids intracellularly.
In the liver
- insulin promotes the uptake and storage of glucose in the form of glycogen, inhibits gluconeogenesis, and promotes the conversion of excess glucose into fat.
Promotes anabolism, and inhibits protein catabolism.

Kat bawah ni kod untuk Gene Sequence beliau (kat receptor SAHAJE, bukan keseluruhan protein tuh.. SUBHANALLAH~)

ATGGGCACCGGGGGCCGGCGGGGGGCGGCGGCCGCGCCGCTGCTGGTGGCGGTGGCC
GCGCTGCTACTGGGCGCCGCGGGCCACCTGTACCCCGGAGAGGTGTGTCCCGGCATGG
ATATCCGGAACAACCTCACTAGGTTGCATGAGCTGGAGAATTGCTCTGTCATCGAAGG
ACACTTGCAGATACTCTTGATGTTCAAAACGAGGCCCGAAGATTTCCGAGACCTCAGT
TTCCCCAAACTCATCATGATCACTGATTACTTGCTGCTCTTCCGGGTCTATGGGCTCG
AGAGCCTGAAGGACCTGTTCCCCAACCTCACGGTCATCCGGGGATCACGACTGTTCTT
TAACTACGCGCTGGTCATCTTCGAGATGGTTCACCTCAAGGAACTCGGCCTCTACAAC
CTGATGAACATCACCCGGGGTTCTGTCCGCATCGAGAAGAACAATGAGCTCTGTTACT
TGGCCACTATCGACTGGTCCCGTATCCTGGATTCCGTGGAGGATAATCACATCGTGTT
GAACAAAGATGACAACGAGGAGTGTGGAGACATCTGTCCGGGTACCGCGAAGGGCAA
GACCAACTGCCCCGCCACCGTCATCAACGGGCAGTTTGTCGAACGATGTTGGACTCAT
AGTCACTGCCAGAAAGTTTGCCCGACCATCTGTAAGTCACACGGCTGCACCGCCGAAG
GCCTCTGTTGCCACAGCGAGTGCCTGGGCAACTGTTCTCAGCCCGACGACCCCACCAAG
TGCGTGGCCTGCCGCAACTTCTACCTGGACGGCAGGTGTGTGGAGACCTGCCCGCCCC
CGTACTACCACTTCCAGGACTGGCGCTGTGTGAACTTCAGCTTCTGCCAGGACCTGCA
CCACAAATGCAAGAACTCGCGGAGGCAGGGCTGCCACCAATACGTCATTCACAACAAC
AAGTGCATCCCTGAGTGTCCCTCCGGGTACACGATGAATTCCAGCAACTTGCTGTGCA
CCCCATGCCTGGGTCCCTGTCCCAAGGTGTGCCACCTCCTAGAAGGCGAGAAGACCATC
GACTCGGTGACGTCTGCCCAGGAGCTCCGAGGATGCACCGTCATCAACGGGAGTCTGA
TCATCAACATTCGAGGAGGCAACAATCTGGCAGCTGAGCTAGAAGCCAACCTCGGCCT
CATTGAAGAAATTTCAGGGTATCTAAAAATCCGCCGATCCTACGCTCTGGTGTCACTT
TCCTTCTTCCGGAAGTTACGTCTGATTCGAGGAGAGACCTTGGAAATTGGGAACTACT
CCTTCTATGCCTTGGACAACCAGAACCTAAGGCAGCTCTGGGACTGGAGCAAACACAA
CCTCACCACCACTCAGGGGAAACTCTTCTTCCACTATAACCCCAAACTCTGCTTGTCAG
AAATCCACAAGATGGAAGAAGTTTCAGGAACCAAGGGGCGCCAGGAGAGAAACGACAT
TGCCCTGAAGACCAATGGGGACAAGGCATCCTGTGAAAATGAGTTACTTAAATTTTCT
TACATTCGGACATCTTTTGACAAGATCTTGCTGAGATGGGAGCCGTACTGGCCCCCCG
ACTTCCGAGACCTCTTGGGGTTCATGCTGTTCTACAAAGAGGCCCCTTATCAGAATGT
GACGGAGTTCGATGGGCAGGATGCGTGTGGTTCCAACAGTTGGACGGTGGTAGACAT
TGACCCACCCCTGAGGTCCAACGACCCCAAATCACAGAACCACCCAGGGTGGCTGATGC
GGGGTCTCAAGCCCTGGACCCAGTATGCCATCTTTGTGAAGACCCTGGTCACCTTTTCG
GATGAACGCCGGACCTATGGGGCCAAGAGTGACATCATTTATGTCCAGACAGATGCCA
CCAACCCCTCTGTGCCCCTGGATCCAATCTCAGTGTCTAACTCATCATCCCAGATTATTC
TGAAGTGGAAACCACCCTCCGACCCCAATGGCAACATCACCCACTACCTGGTTTTCTGG
GAGAGGCAGGCGGAAGACAGTGAGCTGTTCGAGCTGGATTATTGCCTCAAAGGGCTG
AAGCTGCCCTCGAGGACCTGGTCTCCACCATTCGAGTCTGAAGATTCTCAGAAGCACAA
CCAGAGTGAGTATGAGGATTCGGCCGGCGAATGCTGCTCCTGTCCAAAGACAGACTCT
CAGATCCTGAAGGAGCTGGAGGAGTCCTCGTTTAGGAAGACGTTTGAGGATTACCTGC
ACAACGTGGTTTTCGTCCCCAGAAAAACCTCTTCAGGCACTGGTGCCGAGGACCCTAGG
CCATCTCGGAAACGCAGGTCCCTTGGCGATGTTGGGAATGTGACGGTGGCCGTGCCCAC
GGTGGCAGCTTTCCCCAACACTTCCTCGACCAGCGTGCCCACGAGTCCGGAGGAGCACAG
GCCTTTTGAGAAGGTGGTGAACAAGGAGTCGCTGGTCATCTCCGGCTTGCGACACTTCA
CGGGCTATCGCATCGAGCTGCAGGCTTGCAACCAGGACACCCCTGAGGAACGGTGCAGTG
TGGCAGCCTACGTCAGTGCGAGGACCATGCCTGAAGCCAAGGCTGATGACATTGTTGGCC
CTGTGACGCATGAAATCTTTGAGAACAACGTCGTCCACTTGATGTGGCAGGAGCCGAAG
GAGCCCAATGGTCTGATCGTGCTGTATGAAGTGAGTTATCGGCGATATGGTGATGAGG
AGCTGCATCTCTGCGTCTCCCGCAAGCACTTCGCTCTGGAACGGGGCTGCAGGCTGCGTG
GGCTGTCACCGGGGAACTACAGCGTGCGAATCCGGGCCACCTCCCTTGCGGGCAACGGCT
CTTGGACGGAACCCACCTATTTCTACGTGACAGACTATTTAGACGTCCCGTCAAATATTG
CAAAAATTATCATCGGCCCCCTCATCTTTGTCTTTCTCTTCAGTGTTGTGATTGGAAGTA
TTTATCTATTCCTGAGAAAGAGGCAGCCAGATGGGCCGCTGGGACCGCTTTACGCTTCTT
CAAACCCTGAGTATCTCAGTGCCAGTGATGTGTTTCCATGCTCTGTGTACGTGCCGGACG
AGTGGGAGGTGTCTCGAGAGAAGATCACCCTCCTTCGAGAGCTGGGGCAGGGCTCCTTCG
GCATGGTGTATGAGGGCAATGCCAGGGACATCATCAAGGGTGAGGCAGAGACCCGCGTGG
CGGTGAAGACGGTCAACGAGTCAGCCAGTCTCCGAGAGCGGATTGAGTTCCTCAATGAGG
CCTCGGTCATGAAGGGCTTCACCTGCCATCACGTGGTGCGCCTCCTGGGAGTGGTGTCCAA
GGGCCAGCCCACGCTGGTGGTGATGGAGCTGATGGCTCACGGAGACCTGAAGAGCTACC
TCCGTTCTCTGCGGCCAGAGGCTGAGAATAATCCTGGCCGCCCTCCCCCTACCCTTCAAG
AGATGATTCAGATGGCGGCAGAGATTGCTGACGGGATGGCCTACCTGAACGCCAAGAAG
TTTGTGCATCGGGACCTGGCAGCGAGAAACTGCATGGTCGCCCATGATTTTACTGTCAA
AATTGGAGACTTTGGAATGACCAGAGACATCTATGAAACGGATTACTACCGGAAAGGG
GGCAAGGGTCTGCTCCCTGTACGGTGGATGGCACCGGAGTCCCTGAAGGATGGGGTCT
TCACCACTTCTTCTGACATGTGGTCCTTTGGCGTGGTCCTTTGGGAAATCACCAGCTTG
GCAGAACAGCCTTACCAAGGCCTGTCTAATGAACAGGTGTTGAAATTTGTCATGGATGG
AGGGTATCTGGATCAACCCGACAACTGTCCAGAGAGAGTCACTGACCTCATGCGCATGT
GCTGGCAATTCAACCCCAAGATGAGGCCAACCTTCCTGGAGATTGTCAACCTGCTCAAGG
ACGACCTGCACCCCAGCTTTCCAGAGGTGTCGTTCTTCCACAGCGAGGAGAACAAGGCTC
CCGAGAGTGAGGAGCTGGAGATGGAGTTTGAGGACATGGAGAATGTGCCCCTGGACCG
TTCCTCGCACTGTCAGAGGGAGGAGGCGGGGGGCCGGGATGGAGGGTCCTCGCTGGGT
TTCAAGCGGAGCTACGAGGAACACATCCCTTACACACACATGAACGGAGGCAAGAAAAAC
GGGCGGATTCTGACCTTGCCTCGGTCCAATCCTTCCTAA

huwahuwaaaaaa

Ade 5 Steps dalam production of Glargin Insulin

1. FERMENTATION
  • Lantus is produced by recombinant DNA technology utilizing a non-pathogenic laboratory strain of Escherichia coli (K12) as the production organism.
  • Insulin glargine differs from human insulin in that the amino acid asparagines at position A21 is replaced by glycine and two arginines are added to the C-terminus of the B-chain.
  • Genetically modified E.Coli bacteria are cultured and grown in fermenters.
  • Then killed by disinfectant.

2. CENTRIFUGATION
  • Bacterial suspension is concentrated and then disintegrated.
  • In some cases:
- Samples were centrifuged at 10,000g for 30 min and postmitochondrial supernatant was used for fatty acyl-CoA oxidase assay. (if there’s lipid involve)


3. SEPARATION & ISOLATION
  • Fusion protein is separated from the other cell components.
  • In some cases:
- Using chromatographic separation or;
- Separated by differential ultracentrifugation at 100,000g (Beckman Ultracentrifuge)
  • Then, washed twice with water then isolated.

4. PURIFICATION
  • Glargin insulin is freed of urea and inorganics salts with adsorption-desorption steps and simultaneously concentrated.

5. END PRODUCT TREATMENT
  • Produce a product of medicine in solid and liquid phase in a clean room at least in class C
  • Insulin product is crystallized, deep frozen (under clean room conditions) and is then ready for fill and finished.
  • The new inhalable insulin product requires the insulin to be put through a process called micronization (very small particles are produced suitable for blister capsules to be used in a normal inhaler).

Tapi, setakat ni, Galrgine insulin terdapat dalam bentuk injection je. Yang inhalable tu very new technology. Setakat ilmu ana yang amat skeeettttt ni la.. huhuuhh

___________________

Mmmm, dah lame takde pengisian tarbiyyah kan.
Dalam kesibukan esemen, projek, test, kuiz dan final exam, ana doakan iman kite masih mengharum walaopun bizi-bizi ni..

Ana cadangkan, kalo bizi sangat, kite habiskan at least beberapa minit untuk bace buku tarbiyyah (bace al-Quran of kos ari-ari). Satu muka setiap ari pun jadi la. Asalkan tarbiyyah tu still berjalan setiap ari .. p(^0^)q kambatte minna-san!

2 comments

  1. littlewonder Says:
  2. caparah, rase cam nak giler bt bende alah ni..aaaa..hahaha. alhamdulillah,segalenye selesai.

    final2 pun ade gak projek final lagi.bile mase nak study ni.konon je.hahaha

     
  3. salam..

    diey, hahahaaa..kunun r nk stadi. wehhhh~ anira dh abih std chptr 11 pci. fuyoooo~

     
bookmark
bookmark

ShoutMix chat widget